1. cavy husbandry in the socio-economic at

1.   
Introduction

Cavy is a promising livestock especially in sub-Saharan
Africa because it requires little capital, provides quality and cheap meat (NRC,
1991; Lammers et al., 2009), can be afford by poor people. Cavies are early and
prolific (Dikko et al., 2009; Lammers et al., 2009), when subjected to adequate
nutrition and clean environment, they reproduce rapidly with less health care
compared to other species such as rabbits (NRC 1991; Lammers et al., 2009) and
therefore constitute a guarantee of food security (Ngoupayou et al., 1995). In most countries of the Great Lakes regions,
cavies are predominantly higher than rabbits or pigs (Metre, 2012; Maass et al.,
2012). They are well suited to family farming systems where they would
constitute with the rabbit the major source of animal protein for family consumption,
other species serving as source of income for the household (Lammers et al.,
2009; Metre, 2012; Maas et al., 2013).

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

In eastern DRC, it is currently kept by eight
out of ten households, with numbers ranging from 6 to 30 (Mass et al., 2010; Metre, 2012). This
agrees with previous observations by Schoepf and Schoepf (1987), who reported
about one third of surveyed households in DRC. Previously
consumed exclusively by children, it has become a source of protein for all categories
since the 1990s (Vlassenroot, 2008; Metre, 2011). In urban areas, however,
consumption remains limited due to the accessibility and consideration of cavies
as an animal of poor (Maass et al., 2010; Maas et al., 2013; Maass et al., 2014).
In sub-Saharan Africa, despite the benefits of cavy
husbandry in the socio-economic at household level, their population remains
poorly documented, as they are not included in national census except in
Tanzania (NBS, 2012). It can be estimated that more than 2 million
cavies are kept in DRC, contributing significantly to nutrition security,
especially animal protein, and income generation of some hundreds of thousands
of poor rural and urban households (Maass et al., 2013). The largest cavy
populations being kept in the Kivu provinces, which is probably partly due to
the inclusion of cavies in ‘rehabilitation kits’ of humanitarian NGOs and in
the agricultural portfolio of development agencies who seek to address the
challenges of widespread hunger and malnutrition in the area (Maass et al.,
2013). Despite the role of caviaculture, their history remains unknown and not
documented. Recent research on diversity assessment indicated the existence of
three genes pools in the country. However there were limitation on gene flow
for better caption of the genetic diversity that can guide improvement
strategies (Ayagirwe et al., 2017 unpublished data).  Although it is believed that cavies were
introduced into Africa by missionaries during the colonial period. Cavy production
system has evolved leading to enormous changes in their production and genetic
diversity (Ngou Ngoupayou et al., 1995; Manjeli et al., 1998; Metre, 2005).

The
origin of cavies in DR Congo is currently unknown. It is thought that the first
cavies were kept in the catholic convents led by Belgian and Italian Jesuit
missionaries, around early 20th century when the Catholic Church was
established in Bushi area in Sud-Kivu (Nkunzi, 2005). However that history
relayed on information assembled by word-of-mouth and gathered over decades in
discussions with old (± 80 years) key informants from different villages as no
known written records exist on the history of cavy culture anywhere in DRC
(Maass et al., 2013), as it is the case of other African countries like
Cameroon (Yiva et al., 2014). In this work we proposed to assess the phylogeny
and evolution story of cavy raised for meat consumption in DRC using the very
conservative region of the cytochrome b gene. The objective of this work was 1)
to assess the phylogenetic position of the DR Congo cavies populations, in
order to discern if all share a common origin or if they are the result of
independent evolutionary events, and 2) to evaluate the evolutionary affinities
among the DRC Cavies and others American and European populations, in order to
test previous hypotheses that suggest a close relationship among them. 

2.   
Methodology

2.1.       
Sampled
area   

The sampling zone belongs to four different provinces of
RD Congo. Located on both sides of the Equator, extending between 5° 20′ north
latitude and 13° 50′ south latitude, between 12° 15’and 31° 15 ‘east longitude.
Its natural environment consists of the essential factors that contribute to
the quality and variety of agro-pastoral potential and offer an ecosystem conducive
to the promotion and sustainable development of plant and animal production.
There are four climatic zones: (i) the equatorial zone at the center, with a
warm and humid climate, temperatures varying between 20°c and 32°C, heavy
precipitation exceeding 2,000 mm per year regularly distributed throughout the
year; (ii) the tropical zones, with two very marked seasons as one moves away
from the Equator.  These are: (a) the rainy season, characterized by
precipitation ranging from 800 to 1,500 mm per year and fluctuating
temperatures between 25° and 33°c; (b) the dry season, which can last from 1 –
3 months in the North and from 1 to 6 months (of dry season), in the South,
with temperatures ranging from 17° to 25°C. (iii) the monsoon climate
transition zone, separating humid equatorial and tropical climates, and (iv)
the relatively temperate zone in the eastern part of the country with special
rainfall conditions (on average 60 mm per month), with temperatures varying
between 8°C and 18°c due to the elevation of the relief (FAO, 2010). The
different sampled areas are shown in figure 1.

Blood
samples were collected from 96 adults in four provinces of the DRC, 24 samples
per region (South and North Kivu, Katanga and Kinshasa) based on their
phenotypic variability, geographic distance location and genetic distance.
Blood samples from each animal was collected from ears and stored on FTA cards
(Whatman® FTA® card technology, Sigma-Aldrich).

2.2.       
Total
DNA extraction and PCR amplification

Total
DNA extraction was carried out at BecA-ILRI Hub using FTA™ Purification Reagent
according to the manufacturer’s protocol. A pairs of primers were designed based
on the cytochrome b gene of the cavy reference sequence NC_000884.1 (D’Erchia
et al., 1996) deposited in GenBank. Primer pairs were designed (Froward:
GCATCTGTCTAGGCCTGCAA and Reverse: GGTTGGCGGGTGTGTAGTTA) to cover variable
regions of the cytochrome b gene, with the primers situated in conserved
region. The amplification products ranged from 600 to 670 base pairs after trimming.

The
PCR amplification was done in a 50 µl reaction volume containing 45 ng DNA, 1X
AccuPower PCR Master Mix (Bioneer, Korea), 0.09ng of each primers and 0.5 mM of
MgCl2 as top up. PCR amplification was performed in a GenAmp ® 9700
PCR system Thermal Cycler (Applied Biosystems) using the following thermal
cycling conditions: initial denaturation of 5 min at 95°C followed by 35 cycles
of 45s denaturation at 94°C, 60s primer annealing at 58°C and 1 min primer
extension at 72 °C, and then a final extension step of 15 min at 72 °C. PCR
product were then evaluated using 1.8% agarose gel on electrophoresis. Prior to
sequencing, amplified products were purified using a
quick-start protocol of Qiagen Qiaquick® Gel Extraction Kit as recommended by
the manufacturer (QIAGEN Inc.) and visualized on 0.8% agarose gels. Samples
were sequenced using the BigDye Terminator v3.1 Cycle Sequencing Chemistry
(Applied Biosystems) and the ABI Prism 3130XL automatic capillary sequencer
(Applied Biosystems, USA) following the manufacturers recommendations by using
the same primers set as described above.

2.3.       
Data
Analysis

Sequences
were assembled and trimmed using the CLC Main Work bench 7.8.1. Both strands of
all sequences were obtained and after blast and conflict resolution, they were
free of indels, premature stop codons and ambiguities in forward and reverse
directions, providing support for their mitochondrial origin (Triant and
DeWoody, 2007).

Phylogenetic analyses

To
evaluate the DRC cavy population phylogeny, two representatives of the Mus
famulus, one of the Oryctolagus cuniculus and one of the Caprolagus hispidus
downloaded from NCBI genbank were include as outgroup taxa. Ten sequences of
wild cavies from genbank have been as well used to evaluate the relationship
between DRC cavies with their closely related: Cavia tshudii (2), C. magna (2),
C. fulgida (2), C. apera (2) and C. patzelti (2). However to compare domestic
cavies from DRC with other cavy populations, 18 sequences have been downloaded
from the NCBI genbank (one from Europe, six from Colombia, five from Peru, two
from Chili, three from Bolivia and one from Ecuador). Details for the
downloaded sequences are given in table 1.

Multiple
alignments were first performed and displayed using the Mega6 (Tamura, 2013),
then carefully examined and manually edited to maximize the overall similarity.
The Bayesian Information Criterion were used to describe the best evolutionary
model for these data. Akaike Information Criterion identified the Kimura 2-parameter model
taking
into account the proportion of invariable sites and following a gamma
distribution for variable sites as most appropriate fit to our data (Kimura, 1980) due to its lowest maximum log
likelihood (-1195.4608) and lowest Bayesian Information
Criterion (4941.856) with the highest Akaike Information Criterion
identified (2855.565). The tree with the
highest log likelihood is shown. The percentage of trees in which the
associated taxa clustered together is shown next to the branches. Initial
tree(s) for the heuristic search were obtained by applying the Neighbor-Joining
method to a matrix of pairwise distances estimated using the Maximum Composite
Likelihood (MCL) approach. A discrete Gamma distribution was used to model
evolutionary rate differences among sites. The tree is drawn to scale, with
branch lengths measured in the number of substitutions per site. 1000 bootstrap
have been used and the analysis involved a total of 634 positions in the final
dataset. Evolutionary analyses were conducted in MEGA6 (Tamura et al., 2013).

3.   
Results

3.1.       
Phylogenetic
relationship between DRC Cavies and their relatives wild cavies

The
phylogenetic tree based on genetic distances and reconstructed by NJ is shown in
Fig.2. The topology reported shows three major clusters, one including domesticated
cavies from DR Congo with their closely related Cavia utschudii with
relatively high bootstrap values. One with only Cavia magna (100 bootstrap value) and the third comprising Cavia apera, C. fulgida and C. patzelti although bootstrap support
for this clade was relatively low (Fig. 2). 
It appears that the studied DRC cavy population clustered far apart from
the wild cavies and are only related with C.
utschudii (bootstrap value more varying between 80 and 100%). The different
wild cavies are distinctly different from one another based on the length of
the branches. In DRC population however there is sub-clustering of the
domesticated cavies which shows relatively two groups (bootstrap value = 60%).

 

3.2.       
DRC
Cavy population phylogeny compared to their clothier taxa

The
figure 3, based on genetic distances and reconstructed by NJ, it indicates that
there is three clusters. A clear differentiation is observed between cavy
populations from DRC and two others clusters comprising of the Mus famulus and the Oryctolagus cuniculus clustered with Caprolagus hispidus.
However on that phylogeny tree it appears that cavy populations are more
clothier to mouse than they do for rabbit. 
All the cavies from DRC clustered in a unique big cluster with 99%
bootstrap value. Between the DRC cavy population cluster, there is existence of
sub-clustering. However, that clustering is not due to cavy population origin.
Some individuals from Kinshasa clustered far apart from the rest of the group
with 60% bootstrap value. The existence of the admixture of cavy individuals
from different regions implies the evidence of sharing the same genetic
background and the exchange at a certain level of the genetic materials. The
low genetic distance exiting between these populations.

3.3.       
DRC
Cavy population relationship compared to other Latin American domesticated cavy
populations

The history of cavy introduction in
DR Congo is not known. Their origin is however speculated as well as the
introduction and dissemination route. It is believed that they came from South
America but the real country of origin is not yet clearly established. We
considered cavies from six Latin American countries (Peru, Colombia, Chili,
Ecuador, Bolivia and Argentina) and from Europe to trace the dissemination route
and probable country of origin. From the figure it appears that all DRC cavies
were clustered with a pet cavy form Argentina and Europe as well as with some
individuals from Peruvian domestic cavy (with 66% confidence). The second
cluster belongs to cavies from Colombia which are as well clothier to DRC
cavies than the rest do. Some sequences of cavies from Chili, Bolivia, Peru and
Colombia clustered together and are the one very distant from the DRC sequences.
Possible existence of high genetic diversity exist in South America population
and only a narrow genetic material have moved to Europe during the immigration.
As it have been shown previously, the European specimens clearly originate from
South America (see Spotorno et al., 2006); and suggestion that European cavies
either originate from the Caribbean or possibly directly from Colombia and
Peru. It is as well clear that cavies transited from Europe before introduction
to Africa. The presence of Argentina pet in the same cluster of DRC cavies and
Europe is in accordance with the migration purpose of cavy as laboratory and
pet animal than the actual use it deserve in Africa as source of meat for
consumption.

3.4.       
Discussion

Cavies are reported to have been
domesticated at least 4.500 years ago (Sandweiss and Wing, 1997) in the highlands of South America
providing the Indians with meat and sacrificial animals. However, opinion still
dived on the real ancestor of Cavia
porcellus as two wild cavy were known to be related; C. apera and C. utschudii.
These two wild cavies are known to reproduce with the domesticated cavies
fertile offspring (Kruska and Steffen, 2012; Kruska, 2013). Kruska and Steffen
(2012) observed when doing comparative allometric investigations on the skulls
of wild cavies (Cavia aperea) versus
domesticated cavies (C. porcellus)
that C. apera is the ancestor of the
domesticated cavies. “Cavia tschudii” mainly distributed in Peru and
Chile being considered as a subspecies of the species Cavia aperea, which is widely distributed on the South American continent.
This have been based on configuration of the upper M3 occlusal surface of all
the wild Cavia aperea including those
from Andean regions but also from far northern and far eastern distribution as
well as of the domesticated cavies. When comparing chromosome (Weir 1974;
Künzel and Sachser, 1999) as well as DNA investigations (Trillmich et al.,
2004), these different authors suggested the origin of domesticated cavies from
Cavia aperea.

However, Recently Spotorno et al.
(2004, 2006, 2007) revitalized older assumptions, when investigating the origin
of domesticated cavies by use of molecular genetic methods as well as skull
measures and some other morphological traits. As a result they derived all
domesticated cavies from a species Cavia
tschudii with a distribution in the East Andean regions of Peru and
northern Chile rather than from the species Cavia
aperea of adjacent Bolivia.

In this study, domesticated cavies
from DRC clustered with C. utshudii
and far apart from C. apera while
using cytochrome b gene sequences. However phylogenetic inference determined
that Cavia porcellus species share
hereditary characteristics with para phyletic group Cavia tschudii and Cavia
aperea animals confirming Cavia
porcellus offspring from Cavia
tschudii (Diaz et al., 2016).

The history of cavy introduction in
DR Congo is not known. Their origin is however speculated as well as the route
of introduction. It is believed that they came from South America but the real
country of origin is not yet clearly established. Two possible introduction to
Africa are reported; Blench (2000), assumes that they have only been introduced
by Christian missionaries and colonial agricultural officers. Whereas Morales
(1995) suggests that the misnomer ‘Guinea pig’ may have inferred from the European assumption that cavies came from the
West African coast of Guinea after being imported from South America via the
Guinea slave trade ships. From this study, it appears that all DRC cavies were
clustered with a pet cavy from Argentina and Europe as well as with some
individuals from Peruvian domestic cavy. It is there clearly showed that
domesticated cavies in DRC were most likely from Peru and Colombia and have transited
by Europe before their introduction in Africa. This would suggest as well
various introduction of animals from the two countries. However, depending on
their small size characteristics they still comparable with their closely
related cavies (Criollos) which still be founded in rural areas in Latin
America. The present South American populations are probably the descendants of
pre-Columbian lineages. Whether Andean and laboratory/pet breeds are
genetically distinct is uncertain (Spotorno, 1982). However Cavia porcellus have been well-known
domestic pets since their introduction to Europe in the sixteenth century, from
undocumented sources (Woods, 1993; Woods and Kilpatrick, 2006); they became the
prototype of laboratory models through the nineteenth century (Wagner and
Manning, 1976). However they probably had a recent common ancestor around the
sixteenth century (Wagner and Manning, 1976). In fact, molecular analyses of
Peruvian cavies breeders (Chauca, 1997) differentiate with the prolific,
large-sized cavies exhibiting a calm behavior (improved cavies), and the
small-sized, nervous ones (the “criollos” = creoles), typically found in rural
houses (Archetti, 1997), suggest that improved cavies share a most recent
common ancestor with the European cavy which is not the ancestor of creoles
(Spotorono et al., 2004). Cavies brought to Europe were then subjected to
further selective breeding leading to the common domestic form that is nowadays
used as pets and laboratory animals (Spotorno et al., 2006). Their wild relative, the wild cavy
(Cavia aperea) still is one of the
most common and widespread rodents of South America (Asher
et al., 2004; Asher et al., 2008 and Rood, 1972).

Domesticated cavies follow a three-step
process (Spotorno et al., 2006): a first ancient domestication (Wing, 1986),
from the wild species to the domestic pre-Columbian cavy, still bred as the
‘criollo’ (creole) breed throughout the Andean countries; a second step
involving European peoples, who took a few in the XVI century and transformed
them into the present worldwide laboratory/pet cavy (Spotorno et al., 2004);
and a third step involving a modern selection regime of creole cavies (Chauca, 1997),
to produce an improved animal for meat production known in South American
countries (Morales 1995). This have been made possible, in recognition that cavies
can reproduce up to five generations per year (Trillmich, 2000) and concerning
the length of the domestication period they thus have lived under this
influence for much more generations than have the other domesticated lagomorphs
and rodents and even than the other so?called classical domesticated forms
(e. g., dog, sheep, goat, cattle, pig, etc. (Kruska, 2013)) which led to very
different cavies categories. From Europe cavies have been then introduced to
Africa during precolonial period.

However in DRC, the period of that
introduction still unknown. It has been conveyed that the first cavies were
held in the catholic convents in Sud-Kivu, led by Belgian and Italian Jesuit
missionaries, probably starting around the early 20th century, when the
Catholic Church established itself in the Bushi area (Nkunzi, 2005). In the
early colonial period, local people had no specific interest in cavies. Though,
some of those working in the convents introduced the animal into their villages
(Mugisho, 1995), probably to supply meat to their children. Many people,
however, thought cavies were a kind of rat and, hence, adults scorned their
children’s animal inside the houses.

However, the chaos caused by the
succession war for the Mwami Kabare (1985-1987) resulted in widespread famine
and high levels of malnutrition, especially in children (Makungu, 2006). Then,
cavies became considered as a ‘medical treatment’ for malnutrition,
particularly in overcoming anemia (Mugisho, 1995). Some NGOs, such as Comité
Anti-Bwaki5, recommended that children received cavy blood, mixed with Coca
Cola and tomato concentrate to overcome the condition. The belief that cavy
blood and meat has a health-improving effect especially for children
perpetuates until today, also in other parts of the country (B Kajinga-Mutombo,
2013, pers. comm.).

In a survey conducted in the early
1980s in four mountainous localities in Kabare territoire of Sud-Kivu near
Mulungu, Schoepf and Schoepf (1987) found that in one third of the 160
households visited, older children raised cavies, which they consumed. This has
to be seen in the context where mothers usually leave starchy staples prepared
in the home before they leave to the fields; when children return from school,
they prepare cavy stew by themselves. Kunze et al. (1991) recognized the
importance of cavy culture at that time in Kabare territoire based on its
prevalence and its reported contribution to animal-source protein provision for
children. Mugisho (1995) describes cavies as “omnipresent” in Mulamba
groupement in Walungu territoire, the large majority (83%) of 40 interviewed
households from four villages kept cavies successfully for a long time, meaning
at least since independence in the 1960s.

All DRC cavies were clustered in
only one group with less differentiation. When establishing a nucleus of cavies
for a selection program in the Institut supérieur agro-vétérinaire in
Mont-Ngafula in Kinshasa in 2008, populations were introduced from the Kivu
provinces, Lubumbashi and different villages and cities in the Bas-Congo province,
such as Kimpese and Kisantu. Strong cavy nuclei seem to thrive unnoticed in all
these areas as very few official reports are to be found that mention cavies
(Maass et al., 2013). This movement of animal may be one of the raisons why DRC
cavy are closely related.

4.   
Conclusion

The
studied cavies from DRC were less differentiated due to the animal exchange and
genetic introgression. The phylogenetic tree confirmed the hypothesis of C. utschudii being the ancestor of
domesticated cavies. The most plausible road of dissemination of cavies were
Latin America to Africa via Europe and not the direct introduction. Cavies
transited in Europe with the purpose of research and pet before being used as
meat source in Africa. That road of dissemination may reflect as well the gene
flow and would be tracked in improvement process. Possible existence of high genetic
diversity exist in South America population and only a narrow genetic material
have been introduced to DRC via Europe during the immigration.